subject
Biology, 05.02.2022 09:10 babydogdog4375

A group of scientists discovered a new organism that is composed of many cells, gets its nutrition from decaying organisms, and has cell walls. To what kingdom would the new organism belong? Question 10 options:

Plantae

Fungi

Animalia

Protista

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 06:30
Genetic disorders can result when sister chromatids fail to seperate properly. during what phase is this problem most likely to occur?
Answers: 3
question
Biology, 22.06.2019 11:30
In a population that is in hardy-weinberg equilibrium, there are two possible alleles for a certain gene, a and a. if the frequency of allele a is 0.4, what fraction of the population is heterozygous? a. 0.40 b. 0.60 c. 0.16 d. 0.48
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:00
Autonomous underwater explorers will be used to gather large-scale ocean information select the best answer from the choices provided ot
Answers: 1
You know the right answer?
A group of scientists discovered a new organism that is composed of many cells, gets its nutrition f...
Questions
question
Mathematics, 08.06.2021 02:10
question
Mathematics, 08.06.2021 02:10