Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!
Chart in pdf
Answers: 1
Biology, 22.06.2019 04:00
Select the true statements about eubacteria. most live as decomposers and heterotrophs. most only thrive in a narrow range of environments. certain eubacteria are responsible for food poisoning. eubacteria thrive in extreme environments.
Answers: 3
Biology, 22.06.2019 06:00
Body temperature is tightly regulated in mammals for example when external temperatures drop too much the body of a mammal responds by in order to its core temperature?
Answers: 2
Biology, 22.06.2019 06:30
How have high taxes on tobacco products impacted the number of people who use them? a. the number of tobacco users has increased. b. the number of tobacco users has decreased. c. the number of tobacco users has not changed. d. the number of adolescent tobacco users decreased, while the number of adult users increased
Answers: 2
Biology, 22.06.2019 10:30
Nkentucky, intoxicating beverages (beer, whiskey, wine, etc.) are involved to some extent in approximately % of collisions fatal to pedestrians.
Answers: 3
Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following f...
Mathematics, 11.05.2021 19:20
Biology, 11.05.2021 19:20
History, 11.05.2021 19:20
Advanced Placement (AP), 11.05.2021 19:20
Mathematics, 11.05.2021 19:20
History, 11.05.2021 19:20
Mathematics, 11.05.2021 19:20
Biology, 11.05.2021 19:20