Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The red letters are the noncoding region, and the black letters are the protein coding region.
ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC
Answers: 2
Biology, 21.06.2019 23:00
Ricardo notices that when he plays soccer in the rain, his ball does not seem to go as far after a kick. what is the best scientific question that ricardo could ask about this observation? is soccer better played in the rain or sun? how does rain affect the distance a soccer ball can travel? how does rain affect the speed of a soccer ball? is soccer affected by the rain?
Answers: 1
Biology, 22.06.2019 02:30
Acertain species of fish can have either long or short fins. the allele for long fins is dominant over the allele for short fins. a heterozygous, long-finned fish is crossed with a homozygous, short-finned fish. of the offspring, will have long fins and be , and will have short fins and be .
Answers: 2
Biology, 22.06.2019 12:10
Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species
Answers: 1
Biology, 22.06.2019 12:30
The direct energy source that drives atp synthesis during respiratory oxidative phosphorylation is
Answers: 1
Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria...
Spanish, 24.03.2020 03:43
Mathematics, 24.03.2020 03:43
Mathematics, 24.03.2020 03:43
History, 24.03.2020 03:44
Mathematics, 24.03.2020 03:44