subject
Biology, 20.11.2021 03:30 Pattondestiny

Describe the process of synapsis during prophase I and explain how genetic recombination occurs

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 15:00
What is the mrna strand that would be copied from this dna strand
Answers: 2
question
Biology, 22.06.2019 03:30
Acommon kind of mechanical weathering is called
Answers: 1
question
Biology, 22.06.2019 11:00
Many organizations release indexes used to measure the development of the world's countries. as we learned in this lesson, these indexes measure many factors, from life expectancy to happiness. in your opinion, what are the three most important factors we can use to determine how developed a country might be? explain your answers in a few sentences.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Describe the process of synapsis during prophase I and explain how genetic recombination occurs...
Questions
question
History, 20.10.2020 18:01
question
Mathematics, 20.10.2020 18:01
question
Chemistry, 20.10.2020 18:01
question
Business, 20.10.2020 18:01
question
Mathematics, 20.10.2020 18:01
question
Medicine, 20.10.2020 18:01