In radishes, flower color can be red, purple or white. The allele for long (O) tuber shape is completely dominant over oval (o). With regard to flower a cross between red and white resulted in purple F1 progeny. When the F1 plants were self-pollinated a phenotypic ration of 1 red: 2purple: 1 white was observed. Determine the F1 and F2 phenotypes from a cross between pure-breeding red long radish and one that pure breeding white oval shaped.

How many years would it take the atlantic ocean to grow 500 centimeters? show your work.

What are the two main phases of a cell cycle

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?