subject
Biology, 13.08.2021 16:30 stphdrn4347

The control in an experiment​ Group of answer choices

​minimizes experimental inaccuracy.

​reduces the experimental errors.

​allows for comparisons to the experimental group.

​is an additional replicate for statistical purposes.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 19:30
You have 2 plants of the same type and same size, same amount of leaves. one of them is put inside the house and the other one is put in the balcony. you water them saturday, one plant with 200 ml and the other with 400 ml of water. which one of your plants need less water? explain.
Answers: 1
question
Biology, 22.06.2019 01:00
The picture shows a fishing technique called trawling. how might trawling affect marine biodiversity
Answers: 1
question
Biology, 22.06.2019 09:00
What should be the strand of complementary dna produced by the strand of dna shown below cgt ata
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The control in an experiment​ Group of answer choices

​minimizes experimental inaccurac...
Questions
question
Mathematics, 25.07.2019 04:00