subject
Biology, 04.08.2021 06:40 maxi12312345

What are the features of Gene Knockout Cell Line Generation? CRISPR/Cas9 Platform brings customers the most comprehensive gene knockout service. We are focusing on CRISPR technology development to serve customer with satisfied products and service. In terms of leading-edge platform, experienced scientists and skilled staff, we have succeeded in generating gene knockout cell line in multiple species, such as human cells, mouse cells, rat cells and monkey cells.

https://www. creative-biogene. com/crispr-cas9/gene-knockout-cell- line-generation. html

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:00
Compare the depth of field when focusing with low power and high power. which power has the greater depth of field?
Answers: 1
question
Biology, 22.06.2019 09:30
Drag each tile to the correct box. the body monitors the levels of oxygen in the blood to regulate breathing. isabel is running in a marathon and is near the finish line. she feels out of breath. how will her nervous system work to generate a reaction? arrange the tiles in chronological order. isabel's breathing rate increases. sensory receptors in the arteries detect low oxygen levels. the brain sends signals through motor neurons. sensory neurons generate an impulse. the central nervous system relays an impulse to certain brain regions.
Answers: 1
question
Biology, 22.06.2019 10:30
In a lab, scientists grew several generations of offspring of a plant using the method shown. what conclusion can you make about the offspring? a. they formed from meiosis and mitosis. b. they have half the number of chromosomes as their parent. c. they have low genetic variability among them. d. they will be able to reproduce only after they grow flowers.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are the features of Gene Knockout Cell Line Generation? CRISPR/Cas9 Platform brings customers...
Questions
question
Mathematics, 26.08.2019 12:00