The 'genus species' name for the common house cat is Felis domesticus, and the genus species name for a mountain lion is Felis concolor. The modern system of classification categorizes house cats and mountain lions in

According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

The table below shows the elements that mainly comprise each of the four layers of earth: elements in layers layer main elements crust oxygen, silicon mantle iron, magnesium outer core iron, nickel inner core iron which of these elements make up the layer that is 0.2 to 1.1 percent of earth's total diameter?