How would the dna of a fish compare to the dna of a lion

Plzzz hurry im being timed ! humans, like other organisms, require energy for growth and repair. when cells create atp for energy, carbon dioxide is produced as a waste product. how does the body respond to this process in order to maintain homeostasis? a. the digestive and respiratory systems interact to move carbon dioxide to the lower intestine, where it is transformed into methane. b. the circulatory and digestive systems interact to move carbon dioxide to the stomach, where it to break down food. c. the nervous and urinary systems interact to move carbon dioxide to the kidneys, where it is absorbed into the bloodstream. d. the circulatory and respiratory systems interact to transport carbon dioxide to the lungs, where it is expelled from the body.

What can be found in every skeletal muscle? a. nerves, bones, cartilage, and connective tissue b. tendons, cartilage, nerves, and blood vessels c. muscle fibers, nerves, connective tissue, and blood vessels d. tendons, nerves, blood vessels, and bones

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?