subject
Biology, 26.05.2021 21:30 nicjeyr

The humpback whale is a large marine mammal that lives wide spread throughout the North Pacific Ocean. Barnacles are small marine crustaceans that will attach themselves to the bodies of humpback whales. Though the barnacles grow on the skin of whales to filter feed, they are too small to harm the whale. This example best defines which of the following commensalism

mutualism

parasitism

predation

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 16:00
Which term refers to the total dollar value of the goods and services produced in a country in a year?
Answers: 1
question
Biology, 22.06.2019 01:30
Twin boys have girlfriends one of the couples have a baby would the dna of the lil baby be the same as the couples dna bc the boys are identical twins
Answers: 1
question
Biology, 22.06.2019 03:30
Based on the topographic map of mt. st. helens, what is the contour interval of the volcano about height is 2,950 m?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The humpback whale is a large marine mammal that lives wide spread throughout the North Pacific Ocea...
Questions
question
Mathematics, 04.12.2020 20:50
question
Geography, 04.12.2020 20:50
question
Biology, 04.12.2020 20:50
question
Mathematics, 04.12.2020 20:50