Biology, 25.05.2021 20:20 wittlemarie
The flow of energy in some Australian food chains is modeled in the energy pyramid below. Based on the model, which consumers would receive the greatest amount of energy captured by the producers in their food chains?
Answers: 3
Biology, 22.06.2019 01:00
Put the following processes of protein synthesis in the correct order: - dna strands unwind and separate - mrna copies dna according to complimentary base pairing - trna's anticodons bring amino acids to the corresponding mrna codons - amino acids bind to each other making a protein - mrna leaves the nucleus - a stop codon is reached, the newly formed protein is released to go do its job for the cell
Answers: 1
Biology, 22.06.2019 08:40
What substance acts to prevent sudden ph changes in bodily fluids?
Answers: 2
Biology, 22.06.2019 10:20
The function of the excretory system is to control homeostasis and
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The flow of energy in some Australian food chains is modeled in the energy pyramid below. Based on t...
Mathematics, 05.05.2020 19:44
Biology, 05.05.2020 19:44
Health, 05.05.2020 19:44
Mathematics, 05.05.2020 19:44
Geography, 05.05.2020 19:44