subject
Biology, 20.05.2021 01:00 willveloz4

Help pls help pls


Help plssss help pls

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 11:40
What are some possible consequences of preventing prescribed burns and natural wildfires
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:10
Which of the following is caused by reproductive isolation within a species? a. a decrease in gene flow b. an increase in genetic flow c. a decrease in genetic drift d. an increase in gene flow
Answers: 2
question
Biology, 22.06.2019 21:20
What will a hypothesis become if supported by repeated expermentation
Answers: 2
You know the right answer?
Help pls help pls
...
Questions
question
Mathematics, 20.09.2020 04:01
question
Chemistry, 20.09.2020 04:01
question
Mathematics, 20.09.2020 04:01
question
Mathematics, 20.09.2020 04:01
question
Mathematics, 20.09.2020 04:01
question
History, 20.09.2020 04:01
question
Mathematics, 20.09.2020 04:01
question
Mathematics, 20.09.2020 04:01