![subject](/tpl/images/cats/biologiya.png)
Biology, 17.05.2021 08:50 harleymichaelbp74jsq
Characters are more likely to exhibit continuous variation when:
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:00
Iron reacts with oxygen to produce iron oxide (rust). this reaction is represented in an equation as 4fe + xo2 → 2fe2o3. identify the value of x that will balance the equation.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Areal dna molecule consists of thousands of these pairs of nucleotides. what is the pairing arrangement of the nitrogen bases
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:30
Which situation is an example of not doing work? lifting a couch throwing a baseball running up stairs carrying a box
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Characters are more likely to exhibit continuous variation when:...
Questions
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 29.09.2021 22:30
![question](/tpl/images/cats/mat.png)
Mathematics, 29.09.2021 22:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 29.09.2021 22:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.09.2021 22:30
![question](/tpl/images/cats/biologiya.png)
Biology, 29.09.2021 22:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.09.2021 22:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 29.09.2021 22:30