Biology, 15.05.2021 09:00 gabypinskyb8045

Help me pls thank you

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 18:10

In general, how long does it take to accomplish a long-term goal? a.a few days to a weekb.a few weeks to a monthc.a few months to a yeard. more than a year

Answers: 2

Answer

Biology, 22.06.2019 01:40

Elephants in the savanna regions of africa dig holes in dried up river beds to reach water lying just below the surface. these holes provide drinking water for other animals as well. so, without the elephants, many animals might otherwise die from lack of water during the dry season. the location in which the elephants live is an example of a/n and the role they play in creating water holes is an example of a a) ecosystem; habitat b) community; niche c) habitat; niche d) niche; habitat

Answers: 1

Answer

Biology, 22.06.2019 11:00

Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Help me pls thank you
...

Questions