subject
Biology, 14.05.2021 16:40 hairystrong1915

Vegetarians (people who do not eat meat) do not need to worry about fat intake.
O True
O False

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 08:00
This is a situation in which genes are attached to an organism's sex chromosomes; the sex of an organism influences the expression of a gene.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 23:50
Which of the following describes what can happen to an enzyme as temperature rises
Answers: 1
question
Biology, 23.06.2019 01:00
If one were to horizontally divide the earth in half at the equator each half would be a
Answers: 2
You know the right answer?
Vegetarians (people who do not eat meat) do not need to worry about fat intake.
O True
...
Questions
question
Biology, 28.03.2020 15:32
question
Mathematics, 28.03.2020 15:50
question
Mathematics, 28.03.2020 15:50
question
Mathematics, 28.03.2020 15:50
question
Mathematics, 28.03.2020 15:51