I need the answer pls don’t tell the wrong answer and this is science
...
Answers: 1
Biology, 21.06.2019 15:00
Dna is the genetic material that makes up living things, and folic acid plays an important role in the information of dna. jon wants to study the effect of folic acid on dna formation in microbes. which statement accurately describes the variables in this study
Answers: 2
Biology, 22.06.2019 03:20
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
Biology, 22.06.2019 04:30
Asmall population of chimpanzees lives in a habitat thant undergoes no change for a long period of time. how will genetic drift affect this population
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 17.10.2019 23:00
Mathematics, 17.10.2019 23:00
Mathematics, 17.10.2019 23:00
Mathematics, 17.10.2019 23:00
English, 17.10.2019 23:00
Physics, 17.10.2019 23:00
Health, 17.10.2019 23:00
Geography, 17.10.2019 23:00
Biology, 17.10.2019 23:00
English, 17.10.2019 23:00
Mathematics, 17.10.2019 23:00
Mathematics, 17.10.2019 23:00
Biology, 17.10.2019 23:00