1. Some gaseous pollutants bond with water to form little droplets known as . a. Rainfall
b. Water droplets
c. Pollution
d. Aerosols

2.Which size of pollution particle is most dangerous to human health?
a. Large particles (10 micrometers wide or more)
b. Medium sized particles (3-10 micrometers wide)
c. Small particles (less than 3 micrometers wide)
d. None, because pollution is not hazardous to human health

3.Which pollutants are hazardous to human health?
a. Sulfur dioxides
b. Carbon Monoxide
c. Volatile organic compounds (VOCs)
d. All of the above

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

How do all types of diffusion/passive transport actually ‘work’ without using even the smallest amount of cellular energy?

Plz ! what does it mean for an allele to be dominant?