Answers: 2
Biology, 22.06.2019 03:30
In a hypothetical breed of dogs, coat color is controlled by two genes. there are six different coat colors in this breed: black, brown, cream, gray, silver, and tan. consider the following crosses. cross 1: black females from a lineage of all black dogs are crossed with brown males from a lineage of all brown dogs. f1 males and females are all black. when f1 are intercrossed, f2 males and females are black or brown. cross 2: black females from a lineage of all black dogs are crossed with tan males from a lineage where all males are tan and all females are cream. f1 males are black, f1 females are gray. when f1 are intercrossed, f2 males and females are black, brown, gray, or tan. cross 3: silver females from a lineage where all females are silver and all males are gray are crossed with brown males from a lineage of all brown dogs. f1 males and females are all gray. when f1 are intercrossed, f2 males are black, brown, gray, or tan, f2 females are cream, gray, silver, or tan. select the correct statements regarding the mode of inheritance of the coat color genes. a) both genes are x-linked. b) both genes are autosomal. c) one of the genes modifies the expression of the other gene. d) each gene has an additive effect on the intensity of coat color. e) each gene independently specifies three colors. f) one of the genes is autosomal, and the other is x-linked.
Answers: 2
Biology, 22.06.2019 06:30
Aplant may open end close its stomata to prevent excess water loss and maintain
Answers: 1
Biology, 22.06.2019 08:30
Which member of the following food chain will be least affected by ddt, a pesticide water pollutant, if bio-magnification is occurring? algae> zooplankton> crayfish> leopard frog> large mouth bass
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What would happen if the seeds are sown in a hard soil? Justify your answer....
English, 19.09.2019 16:30
History, 19.09.2019 16:30
Mathematics, 19.09.2019 16:30
Mathematics, 19.09.2019 16:30
Mathematics, 19.09.2019 16:30
English, 19.09.2019 16:30
History, 19.09.2019 16:30
Social Studies, 19.09.2019 16:30
History, 19.09.2019 16:30