subject
Biology, 22.04.2021 22:10 yugbug44owwc7w

Scientists are studying the evolution of a species of woodpecker with a very long beak. Which statement most likely explains how the environment influenced the development of this species? A. The long beak is a result of many woodpeckers trying to push their beaks into cavities of rocks.
B. The long beak is a trait developed through genetic engineering to make the woodpecker more popular with breeders.
C. The long beak is a trait inherited from another bird species that moved to the woodpecker's environment to mate with woodpeckers.
D. The long beak is an adaptation developed through natural selection to help woodpeckers hunt insects that live deep in tree trunks.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 16:30
Which would prevent a plant from growing
Answers: 1
question
Biology, 22.06.2019 02:20
Humans are believed to have evolved in coastal regions in east africa. the region had an abundant supply of fish for early humanoids to eat. when scientists analyze the fads gene they see an interesting pattern. people whose families have lived in this area of east africa for generation show a high level of diversity in alleles for the fads gene. conversely, people whose families had migrated inland a moderate distance from sources of fish showed a much lower diversity for fads gene alleles. additionally, the fads alleles found in people whose family has lived inland for generation are almost all gene alleles which produce fads proteins with a high level of function and activity. how do anthropologists explain this?
Answers: 3
question
Biology, 22.06.2019 09:10
Which zone within the open-ocean zone is home to the most organisms? deep zone surface zone intertidal zone transition zone
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Scientists are studying the evolution of a species of woodpecker with a very long beak. Which statem...
Questions
question
Mathematics, 21.05.2021 18:20
question
Mathematics, 21.05.2021 18:20
question
Mathematics, 21.05.2021 18:20