Answers: 1
Biology, 21.06.2019 18:50
The eruption of a nearby volcano causes a prairie ecosystem to receive a lot less sunlight.which of these is the most likely effect on the ecosystem? a-an increase in biodiversity. b-an increase in immigration to the area. c-a decrease in available water. d-a decrease in plant growth.
Answers: 2
Biology, 22.06.2019 00:40
3points hurry! what is the relationship between biotechnology, sharkskin, and disease resistance? bioengineers have developed an artificial sharkskin that does not allow resistant bacteria to grow on it. disease-causing microbes have been genetically modified to keep them from infecting the skins of sharks. scientists have created a device that can be attached to the skins of sharks that dramatically increases their abilities to resist disease. sharkskin produces many chemicals that can be collected and used to create antibiotics.
Answers: 1
Biology, 22.06.2019 07:20
Agroup of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. if the mitochondria were unharmed, what would happen to the overall function of the plant cells? a. the cells would not be able to make food, but would be able to release energy from biomolecules. b. the cells would not be able to replicate dna, but would be able to break down waste. c. the cells would not be able to break down waste, but would be able to replicate dna. d. the cells would not be able to release energy from biomolecules, but would be able to make food.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Vocal variation, intensity, pacing and use of fillers are a part of which of the speaking competenci...
Mathematics, 05.01.2020 01:31
English, 05.01.2020 01:31
Mathematics, 05.01.2020 01:31
Mathematics, 05.01.2020 01:31
Mathematics, 05.01.2020 01:31
Mathematics, 05.01.2020 01:31