Biology, 19.08.2019 00:30 rileyeddins1010
Huntington’s disease is due to an autosomal dominant allele. if a heterozygous male marries a normal female, what percentage of the offspring will have huntington’s?
Answers: 1
Biology, 21.06.2019 15:00
What is a coast of using technology to transport water? a.cities can be built in otherwise uninhabitable areas. b.crops can be irrigated and grown in new areas. c.floods can be averted in flood-prone areas. d.freshwater supplies can be depleted in an area.
Answers: 2
Biology, 21.06.2019 15:30
Which prevent errors in dna replication? a. helicase enzyme checks the dna for errors. b. each base can attach to only one other type of base. c. ribosome enzymes prevent errors from happening. d. dna contains no complementary base pairs.
Answers: 1
Biology, 22.06.2019 01:20
Which organelles are labeled d, and what is one feature that distinguishes them from the other labeled organelles chloroplasts the only organelles that produce sugars from sunlight mosomes, only found in animal and bacterial cells centricles only found in animal cells mitochondra, the only energo-generating structures found in cells
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Huntington’s disease is due to an autosomal dominant allele. if a heterozygous male marries a normal...
Mathematics, 05.01.2021 22:50
Social Studies, 05.01.2021 22:50
Mathematics, 05.01.2021 22:50
Computers and Technology, 05.01.2021 22:50
Mathematics, 05.01.2021 22:50
History, 05.01.2021 22:50
History, 05.01.2021 22:50
History, 05.01.2021 22:50
Mathematics, 05.01.2021 22:50
Physics, 05.01.2021 22:50
English, 05.01.2021 22:50