Which statement is true about sodium and chlorine?
a. they usually occur as gases at room temperature
b. they have the same kind of subatomic particles
c. they are both solids in their natural state
d. they are close together in the periodic table

Which of the following is one of the four conditions necessary for natural selection to occur in a population? fewer organisms are born than the habitat can support mutation does not occur organisms have identical characteristics variation is inherited

Toorale man murder mystery < - your lab link 1. how was the toorale man found? 2. what did archaeologists learn about the burial? why is the burial important? 3. what information were the scientists able to learn from the skeleton itself? 4. why is the question of whether the injuries came from a stone or steel weapon important? how could scientists distinguish between the different types of weapons? 5. what did the carbon dating and soil testing tell scientists about toorale man? why are the dates interesting for scientists?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?