Construct a chart to contrast mitosis and meiosis. include the following:
a. the number and t...
Construct a chart to contrast mitosis and meiosis. include the following:
a. the number and type cells produced
b. the number of replications of dna
c. the number of actual divisions of cells
d. the formation of tetrads (pairs of homologous chromosomes)
e. the use of the terms diploid and haploid in the resulting cells
Answers: 1
Biology, 21.06.2019 15:30
15 points come and ! which characteristic describes all bacteria? a rod-shaped b microscopic c multicellular d autotrophic
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30
Black fur(b) in guinea pigs is dominant over white fur(b). find the probability of a homozygous offspring in a cross: bb x bb. a. 0% b. 25% c. 50% d. 75% e. 100%
Answers: 2
Mathematics, 03.08.2019 05:30
Business, 03.08.2019 05:30
Mathematics, 03.08.2019 05:30
History, 03.08.2019 05:30
Advanced Placement (AP), 03.08.2019 05:30
History, 03.08.2019 05:30
Mathematics, 03.08.2019 05:30
World Languages, 03.08.2019 05:30
Spanish, 03.08.2019 05:30
Spanish, 03.08.2019 05:30
World Languages, 03.08.2019 05:30
English, 03.08.2019 05:30