1. moss plants are held in place by threadlike structures called while ferns are supported by

(1 point)
rhizomes; roots
rhizoids; roots and stem
guard cells; rhizomes
vascular tissue; stems
2. ferns are the most abundant of the plants; and they produce to reproduce. (1 point)
gymnosperm; sperm
seedless vascular; spores
nonvascular; shoots
vascular; seeds
3. which of the following is a reason mosses never grow very tall? (1 point)
lack of cell walls
presence of cuticles
more complex reproduction
lack of vascular tissue
4. peat is actually the earliest stage of which will be produced over a long period of time
and with a lot of
(1 point)
coal; pressure
natural gas; moisture
petroleum; heat
petrified wood; air

Neelaredoxin is a 15-kda protein that is a gene product common in anaerobic prokaryotes. it has superoxide-scavenging activity, and it is constitutively expressed. in addition, its expression is not further induced during its exposure to o2 or h2o2 (silva, g., et al. 2001. j. bacteriol. 183: 4413–4420). which of the following statements best describes neelaredoxin synthesis? a-neelaredoxin is produced at all times; levels are constant even when exposed to o2 or h2o2.b-neelaredoxin is produced at all times; exposure to o2 or h2o2 increases expression.c-neelaredoxin is produced at all times; exposure to o2 or h2o2 decreases or prevents expression.d-neelaredoxin is only produced when there is exposure to o2 or h2o2.

In which way are mercury and venus similar? they both rotate from east to west. they are both small and rocky. they both have thick atmospheres. they both are similar to earth in structure.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?