subject
Biology, 16.10.2019 22:40 lizzyhearts

How can evidence from an experiment be explained in relationship to the hypothesis?

a.) as a prediction
b.) as a question
c.) as a inference
d.) as a conclusion

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 22:00
Dna is colied into chromosomes in a cell
Answers: 2
question
Biology, 22.06.2019 03:30
How can a geological time scale best be reconstructed? a) comparing vestigial structures in living species b) comparing homologous structures in living species c) examining homologous structures in fossil remains d) examining the written records of scientists from past cultures
Answers: 1
question
Biology, 22.06.2019 09:50
Inbox me girls for s.exy chat and hard fu.c.king
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How can evidence from an experiment be explained in relationship to the hypothesis?

a.)...
Questions
question
English, 19.11.2020 02:40
question
Mathematics, 19.11.2020 02:40
question
Social Studies, 19.11.2020 02:40
question
Mathematics, 19.11.2020 02:40
question
Mathematics, 19.11.2020 02:40