subject
Biology, 29.09.2019 10:20 caeley

Which area of economics studies the behavior of economics on a large scale, such as how different markets affect each other?
a) macroeconomic
b) regional economics
c) microeconomics
d) national economics

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 09:30
What is the difference between a scientific hypotheses and a scientific theory?
Answers: 1
question
Biology, 22.06.2019 10:30
Natural selection changes allele frequencies because some survive and reproduce more successfully than others.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:00
Which areas of earth receive the most precipitation on average? a. tropics b. temperate zones c. regions near 30? n and s latitudes d. polar zones 1
Answers: 1
You know the right answer?
Which area of economics studies the behavior of economics on a large scale, such as how different ma...
Questions
question
Mathematics, 08.07.2019 21:30
question
Mathematics, 08.07.2019 21:30
question
Mathematics, 08.07.2019 21:30
question
Mathematics, 08.07.2019 21:30
question
English, 08.07.2019 21:30
question
Mathematics, 08.07.2019 21:30