subject
Biology, 19.04.2021 23:30 bunnles

34. Transfer the following into DNA: ATGTAGCCTACGTATAATGCA​

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 22:00
Researchers determine that the biodiversity in a woodland region is declining. they identify two major threats to the region's biodiversity, a method to address each threat, and the expected outcome of each method. this information is shown in the table. threat method number of species that benefit number of years to see benefit habitat fragmentation reforestation 450 8 introduced prey species biological augmentation 150 2 which statement is an accurate explanation of the information in the table? a. biological augmentation would benefit only a few species because it is typically not very effective. b. biological augmentation would take less time to be effective because it targets the majority of prey species. c. reforestation would take the longest time to be effective because trees take several years to grow. d. reforestation would not benefit many species because most forest species live on the ground.
Answers: 1
question
Biology, 22.06.2019 04:50
Consider the classification levels of a human. eukarya ,animalia ,chordata ,mammalia ,primates, hominidae ,homo ,sapiens .which is the most specific taxonomic level in the classification system above? a sapiens b homo c hominidae d primates
Answers: 1
question
Biology, 22.06.2019 07:00
When lactate builds up in a runners muscles it causes a burning sensation what causes this to occur
Answers: 1
question
Biology, 22.06.2019 08:30
Gene expression is the activation of a gent that results in a question 1 options: protein dna mitochondria
Answers: 1
You know the right answer?
34. Transfer the following into DNA: ATGTAGCCTACGTATAATGCA​...
Questions
question
Mathematics, 21.11.2020 01:00
question
Business, 21.11.2020 01:00
question
Mathematics, 21.11.2020 01:00