1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Another question on Biology
Biology, 21.06.2019 22:30
White-tailed deer are considered to be an overpopulated species in the central united states. which of these events probably contributed the most to white-tailed deer exceeding their carrying capacity?
Answers: 1
Biology, 22.06.2019 01:00
Coral reefs support more species per unit area than any other marine environment on earth. what is one way coral reefs are important to the health of the biosphere
Answers: 1
Biology, 22.06.2019 03:50
Why was mendel's work not accepted at the time? o a. his results were false. o b. he did not repeat his experiments. o c. he did not have any data. o d. his results were surprising,
Answers: 2
You know the right answer?
Questions
English, 01.05.2021 22:10
Mathematics, 01.05.2021 22:10
Mathematics, 01.05.2021 22:10
Spanish, 01.05.2021 22:10
World Languages, 01.05.2021 22:10
Mathematics, 01.05.2021 22:10
History, 01.05.2021 22:10
Mathematics, 01.05.2021 22:10
Mathematics, 01.05.2021 22:10
Business, 01.05.2021 22:10
History, 01.05.2021 22:10
