Biology, 15.04.2021 06:30 hcortez8846
The roots of the mangrove trees provide food and shelter for many organisms, and keep sand, mud, and organic matter in place, preventing erosion and local flooding. Which of the following environmental changes would have the greatest impact on the coastal community?
Answers: 2
Biology, 21.06.2019 21:00
Epinephrine is a hormone released from the adrenal gland of the body, most often in a stressful situation. it is known as the "fight-or-flight" hormone. one way that it causes a response in the body is to activate receptors on muscle cells. where are these cellular receptors located? a. on the cell membrane b. in the nucleus c. on the cell wall d. around the mitochondria
Answers: 1
Biology, 22.06.2019 03:00
Why do leaves change color in the fall? green pigments break down and no longer mask the color of chlorophyll. chlorophyll breaks down and no longer masks the colors of other pigments. red- and yellow-colored pigments grow and mask green-colored chlorophyll. green-colored chlorophyll breaks down and turns red and yellow.
Answers: 2
Biology, 22.06.2019 10:00
1. fold your hands together so your thumbs cross over ,and look at your thumbs. which thumb feels most "comfortable" on top is actually controlled by a gene. the left thumb folding over the right thumb is a domi
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The roots of the mangrove trees provide food and shelter for many organisms, and keep sand, mud, and...
Mathematics, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
History, 09.10.2019 02:30
Biology, 09.10.2019 02:30
Spanish, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30
Spanish, 09.10.2019 02:30
Mathematics, 09.10.2019 02:30