Answers: 1
Biology, 21.06.2019 13:30
The energy of blowing wind can be harnessed to create electricity. why is wind considered a renewable energy source? a) wind does not cause destruction of the environment.b) wind turns the blades of a windmill that creates electricity.c) wind provides only a very small amount of electricity to the united states.d) wind comes from atmospheric conditions that are available indefinitely.
Answers: 2
Biology, 22.06.2019 02:00
The leopard frog and the pickerel frog are two closely related species. in areas where their ranges overlap, the frogs will remain separate species if they
Answers: 2
Biology, 22.06.2019 08:50
Sort the examples by the type of diversity that they exhibit a park has 80 species of trees red, yellow, and orange bell peppers are all members of the same species individuals of the same lizard species have different mating strategies. five different bird species are at a bird feeder. genetic diversity species diversity
Answers: 1
Biology, 22.06.2019 23:00
Planning along the natural slope of the land to reduce soil erosion is called
Answers: 2
What is the mRNA in TACCGGATGCCAGATCAAATC?...
Mathematics, 24.07.2019 14:00
Mathematics, 24.07.2019 14:00
Biology, 24.07.2019 14:00
History, 24.07.2019 14:00
History, 24.07.2019 14:00
Social Studies, 24.07.2019 14:00