subject

Biology, 14.04.2021 23:40 meowmeowcow

What is the complementary DNA of TACCGGATGCCAGATCAAATC?

ansver

Answers: 1

Show answers

Another question on Biology

question

Biology, 22.06.2019 01:00

Which statement describes john tuzo wilson’s contribution to the theory of plate tectonics?

Answers: 3

question

Biology, 22.06.2019 10:30

Coral have a symbiotic relationship with what in order to eat?

Answers: 2

question

Biology, 22.06.2019 12:30

Analyze how the water cycle affects a food web. now list 3 examples for each below using complete sentences, on how too much water would affect the same web? how about to little water?

Answers: 1

question

Biology, 22.06.2019 14:30

The lineage of pea plants produced round seeds for four generations. the plants that fertilized these pea plants also produced round seeds. however, in the fifth generation, the plant produced to two plants with wrinkled seeds. can that be possible?

Answers: 2

You know the right answer?

What is the complementary DNA of TACCGGATGCCAGATCAAATC?...

Questions

question

History, 07.05.2020 03:11

Which of the following Native American tribes fought against the forces of General Andrew Jackson in Florida in 1818? A. the Navajo B. the Seminole C....

question

Chemistry, 07.05.2020 03:11

The endocrine system works with the system to help the body function....

question

Chemistry, 07.05.2020 03:11

What electrolytes does electricity have...

question

Mathematics, 07.05.2020 03:11

Uppose 56%56% of politicians are lawyers. If a random sample of size 787787 is selected, what is the probability that the proportion of politicians wh...

question

Physics, 07.05.2020 03:11

1. If a force of 40N is applied for 0.2 sec to change the momentum of a volleyball, what is the impulse?...

question

Chemistry, 07.05.2020 03:11

14 H+ + 6 Fe2+ + Cr2O72- . 2 Cr3+ + 6 Fe3+ + 7 H2O This reaction is used in the titration of an iron solution. What is the concentration o...

question

Mathematics, 07.05.2020 03:11

The point P= (x,-1/7) lies on the unit circle shown below. What is the value of x in simplest form?...

question

Mathematics, 07.05.2020 03:11

4(2a^-4a)-2(5a^2+4a-2)...

question

Social Studies, 07.05.2020 03:11

16-year-old high school student Gregory thinks of himself as a member of the "musical clique" at school and feels that the musicians are the best grou...

question

Business, 07.05.2020 03:11

17. Duck-n-Run has projected sales of $120,000 for January, $118,000 for February, and $146,000 for March. The firm collects 55 percent in the month o...

question

Social Studies, 07.05.2020 03:11

Chile is a country in South America which has many different elevations including high mountains and coastal lowlands. Why would temperatures in the m...

question

History, 07.05.2020 03:11

Why was there so little settlement in the Great Plains...

question

Mathematics, 07.05.2020 03:11

Find the slope and y intercept of the line that is perpendicular to y= -x+3 and passes through the point (-6,-4)...

question

Mathematics, 07.05.2020 03:11

Determine the constant of proportionality in the situation below. Each pack of gum costs $2.00...

question

Chemistry, 07.05.2020 03:11

16. You are running a TLC plate with a polar (A) and nonpolar substance (B); your solvent is a hexane and dichloromethane mixture (1:1). Substance B i...

question

English, 07.05.2020 03:11

11. Hawthorne's reference to Lincoln as the man of men" (line 3) A. given added importance by the "of course (line 1). B. rei...

question

Biology, 07.05.2020 03:11

Before manipulating any area of the hubbard brook forest, the researchers spent several years studying the natural watersheds of the forest to try to...

question

Business, 07.05.2020 03:11

Binomial tree farm's financing includes $5 million of bank loans and $6 million book value of 10-year bonds, which are selling at 95% of par value. it...

question

Chemistry, 07.05.2020 03:11

How does wavelength differ in high and low frequency waves?...

question

Mathematics, 07.05.2020 03:11

A large insurance company maintains a central computing system that contains a variety of information about customer accounts. Insurance agents in a s...

More questions: Biology Another questions