Biology, 14.04.2021 06:00 mazielynn84

Which phase describes "movement away from each other" on a molecular level? A) Solid
B) Gas
C) Liquid
D) Methane

Answers: 2

Show answers

Another question on Biology

Biology, 22.06.2019 00:00

What do lava flows made of aa indicate about the type of volcanic eruption that occurred? a. the eruption was viscous. b. the eruption was pyroclastic. c. the eruption was explosive. d. the eruption was quite. !

Answers: 1

Answer

Biology, 22.06.2019 05:00

Dna. we have heard that we are a product of our dna. but where is it? how do we "get" our dna? it is passed to us, from our parents, but in what form? several vocabulary words associated with inheritance are used interchangeably and sometimes, incorrectly. let's see if you can clear this up for someone just learning about inheritance and cell structure.

Answers: 2

Answer

Biology, 22.06.2019 09:00

Group control group #1 experimental group yes yes yes control group #2 no new drug orange juice bed rest no yes no yes ves which of the following is the best explanation of why a second control group was included in this experiment? o a. to provide the volunteers in the study with something to drink o b. to prove that the common cold cannot be cured c. to confuse anyone who is trying to steal their new drug and sell it as their own invention o d. to researchers conclude that results are related to the new drug and not to the orange juice submit e previous

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which phase describes "movement away from each other" on a molecular level? A) Solid
B) Gas

Questions