All cells contain the molecule DNA. Which best explains why DNA is important to all cells?
A) All cells need DNA to process sugars.
B) All cells need DNA to carry information.
C) All cells need DNA to reproduce asexually.
D) All cells need DNA to perform photosynthesis.
Answers: 1
Biology, 22.06.2019 04:00
Of your good in bio kusing a series of preliminary observations; pstate a problem developed from these observations, formulate a hypothesis, design an experiment to test the hypothesis
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:00
First dropdown options: a. runoff b. condensation c. evaporation second dropdown options: a. photosynthesis b. transpiration c. sweating third dropdown options: a. raindrops b. clouds c. animals
Answers: 1
Biology, 23.06.2019 02:00
How did the average and range of beak size differ between birds that survived the drought and birds that dies?
Answers: 2
All cells contain the molecule DNA. Which best explains why DNA is important to all cells?
A) All c...
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Chemistry, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00
Mathematics, 15.12.2021 01:00