subject
Biology, 12.04.2021 19:10 cerickson2481

Homologous structures are body parts of organisms that are similar in structure and position but have different function. Which set of organism
structures are homologous?

a. wing of a bat; wing of a bee

b. flipper of a porpoise; foreleg of an elephant

c. flipper of a whale; leg of a centipede

d. leg of a spider, leg of a frog

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:30
Mutations associated with albinism affect proteins involved in synthesis
Answers: 1
question
Biology, 22.06.2019 02:50
The response is the basis for vaccination. primary secondary tertiary none of the above
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 23:20
Male-patterned baldness is more common in males as the name suggest.why is this? a.the gene for baldness is on chromosome 5 b.the gene for baldness is on chromosome 1 c.the gene for baldness is on he x chromosome d.the gene for baldness is on the y chromosome
Answers: 2
You know the right answer?
Homologous structures are body parts of organisms that are similar in structure and position but ha...
Questions
question
History, 02.03.2020 19:24
question
History, 02.03.2020 19:24
question
Social Studies, 02.03.2020 19:24