subject
Biology, 09.04.2021 18:00 janessa0804

4 points Angiosperms have developed fruit to aid in seed dispersal. How has the
evolution of seed dispersal enhanced the success of angiosperms? *

A. Seeds are better protected from predator
B. Seeds better camouflaged
C. Seeds are better at storing nutrients for survival
D. Seats are moved far from parent play allowing were more resources and less competition

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:00
If the frequency of the p allele is .63 in the population then what is the frequency of the q allele?
Answers: 1
question
Biology, 22.06.2019 03:00
What causes darkening of the skin as melanin production increases
Answers: 1
question
Biology, 22.06.2019 06:10
Long-period comets come from the oort cloud particles in earth’s atmosphere material from the asteroid belt the kuiper belt
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
4 points Angiosperms have developed fruit to aid in seed dispersal. How has the
evolution of...
Questions
question
English, 18.05.2021 20:30
question
Mathematics, 18.05.2021 20:30
question
Mathematics, 18.05.2021 20:30
question
Mathematics, 18.05.2021 20:30