subject
Biology, 08.04.2021 22:20 tporter00

Which of the following should be the first collected at the scene? Adult insects
Larvae
Eggs
The order doesn’t matter.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 15:30
Which properties describe all matter?
Answers: 2
question
Biology, 22.06.2019 10:00
14. which of the following codons code for threonine? a. ucg b. ugu c. cga d. aca
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
You know the right answer?
Which of the following should be the first collected at the scene? Adult insects
Larvae
...
Questions
question
Advanced Placement (AP), 16.02.2021 04:50
question
History, 16.02.2021 04:50
question
Mathematics, 16.02.2021 04:50