Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
What is one reason why transpiration is important in plants? question 19 options: it produces food from the sugar in the plant cells. it enables the flow of water out of the plant. it produces carbon dioxide in the leaves of the plant.
Answers: 1
3. When the mRNA is translated, the order of its codons determines the order of amino acids in the r...
History, 23.11.2020 07:10
Social Studies, 23.11.2020 07:10
Physics, 23.11.2020 07:10
Mathematics, 23.11.2020 07:10
Mathematics, 23.11.2020 07:10
History, 23.11.2020 07:10
Mathematics, 23.11.2020 07:10
History, 23.11.2020 07:10
Mathematics, 23.11.2020 07:10
Mathematics, 23.11.2020 07:10