What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?

Called for cell.

Ithink your answer will be c hope that’s you

Because the earth is not round ,but it may seem round when viewed from ,our planet but true some points earth is not round was an oblate spheroid -a square that it squashed as globe however is not even a perfect oblate spheroid.in fact isaac newton's first proposed that earth was not perfectly round but it was an oblate spheroid instead.that mean a square that is squashed as its poles and swollen at the