18 7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...

Rotenone is an insecticide that is toxic

Nhumans, abo blood types refer to glycoproteins in the membranes of red blood cells. there are three alleles for this autosomal gene: ia, ib, and i. the ia allele codes for the a glycoprotein, the ib allele codes for the b glycoprotein, and the i allele doesn't code for any membrane glycoprotein. ia and ib are codominant, and i is recessive to both ia and ib. people with type a blood have the genotypes iaia or iai, people with type b blood are ibib or ibi, people with type ab blood are iaib, and people with type o blood are ii. if a woman with type ab blood marries a man with type o blood, which of the following blood types could their children possibly have? in humans, abo blood types refer to glycoproteins in the membranes of red blood cells. there are three alleles for this autosomal gene: ia, ib, and i. the ia allele codes for the a glycoprotein, the ib allele codes for the b glycoprotein, and the i allele doesn't code for any membrane glycoprotein. ia and ib are codominant, and i is recessive to both ia and ib. people with type a blood have the genotypes iaia or iai, people with type b blood are ibib or ibi, people with type ab blood are iaib, and people with type o blood are ii. if a woman with type ab blood marries a man with type o blood, which of the following blood types could their children possibly have? a, b, ab, and o ab and o a, b, and o a and b

Pink fur (p) is dominant to purple fur (p) in hamsters. two heterozygous pink hamsters are crossed. what is the probability that these two parents will have an offspring with purple fur? 2/4, 1/2 or 50% 1/4 or 25% 3/4 or 75% 4/4 or 100% there is no chance for this type of offspring