Which of the following best explains the way that a molecular clock can be used A: The number of DNA mutations in an organism is measured over time to determine how long it’ll take for a new species to evolve

B: The number of DNA mutations in a species is compared to the number of DNA mutations in another species to determine the relative amount of time each species have been evolving

C: The number of differences in a specific DNA sequence of two species is multiplied by a known mutation rate to determine the years of evolution that separate the two species

D: The number of differences in the DNA sequences of two organisms of the same species is average to determine how many years of evolution have occurred

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?