subject
Biology, 12.03.2021 06:20 laidbackkiddo412

It stimulates the liver to convert its stores of glycogen back into glucose. This response is known as glycogenolysis. The glucose is then released into the circulation for use by body cells. It stimulates the liver to take up amino acids from the blood and convert them into glucose. This response is known as gluconeogenesis. It stimulates lipolysis, the breakdown of stored triglycerides into free fatty acids and glycerol. Some of the free glycerol released into the bloodstream travels to the liver, which converts it into glucose. This is also a form of gluconeogenesis. in my own words

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 01:00
Which of the following statements is true? a. there are more chromosomes in an organism than there are genes. b. there are more genes in an organism that there are chemical bases. c. dna is made of sugar, phosphate, and carbon. d. genes are found in specific locations on a chromosome.
Answers: 1
question
Biology, 22.06.2019 02:00
The idea of spontaneous generation was disproved by in a experiment involving jars of meat
Answers: 1
question
Biology, 22.06.2019 04:30
Whats one way that rocks do not follow the typical rock cycle pathway?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
It stimulates the liver to convert its stores of glycogen back into glucose. This response is known...
Questions
question
SAT, 01.03.2021 01:40
question
Mathematics, 01.03.2021 01:40
question
Advanced Placement (AP), 01.03.2021 01:40
question
Mathematics, 01.03.2021 01:40
question
Mathematics, 01.03.2021 01:40
question
Mathematics, 01.03.2021 01:40
question
English, 01.03.2021 01:40