1 poi
Cancer is when a cell continually divides which means it never goes back
to what stage?...
Biology, 04.03.2021 02:20 hahaiwannadie
1 poi
Cancer is when a cell continually divides which means it never goes back
to what stage?
Interphase
O Cytokinesis
Mitosis
Prophase
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 20:30
How does the structure of dna hold the information needed to code for the many features of multicellular organisms?
Answers: 2
Biology, 22.06.2019 20:30
Can result as a complication of diabetes due to damage to the arterial walls and excess fat in the blood.
Answers: 1
Biology, 23.06.2019 01:30
If it turned out dinosaurs were colorblind, how would this affect some assumptions scientists have made about them?
Answers: 2
Mathematics, 21.04.2020 19:19
Social Studies, 21.04.2020 19:19
English, 21.04.2020 19:19
Mathematics, 21.04.2020 19:19
Mathematics, 21.04.2020 19:19