Which blood vessels allow substances to pass through their walls? β
...
Biology, 26.02.2021 23:40 robert7248
Which blood vessels allow substances to pass through their walls? β
Answers: 3
Biology, 22.06.2019 06:00
Monomers are the building blocks of larger molecules, called polymers. for example, proteins are composed of chains of amino acids that are linked together. cellulose is a polymer that makes up plant cell walls. cellulose is made from a chain of c6h10o5 molecules. which monomers are most likely used to produce cellulose? why?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:10
Match the correct terms to their descriptions a system in which only energy but not matter is exchanged frozen water in snow part of geosphere that includes only soil a thin layer between the troposphere and the stratosphere cryosphere tropopause closed system pedosphere
Answers: 2
Biology, 22.06.2019 15:40
Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done
Answers: 2
Business, 24.07.2019 05:30
Biology, 24.07.2019 05:30
Mathematics, 24.07.2019 05:30
Mathematics, 24.07.2019 05:30
History, 24.07.2019 05:30
Social Studies, 24.07.2019 05:30
English, 24.07.2019 05:30
Social Studies, 24.07.2019 05:30