AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

According to this food web which of the following would be considered primary consumers

Suppose you use three different scale to weigh a bag of oranges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of oranges is 2.153 lb. which of the following best decribes these results?

Which of the following terms best matches this definition: the process where humans choose the traits that will be present in the next generation through breeding. question 4 options: genetic determinism artificial selection acquired selection natural selection