subject
Biology, 19.02.2021 21:40 etwerner23

Help me fast asap thx​


Help me fast asap thx​

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 22:00
What are charcteristics of lithosphere?
Answers: 1
question
Biology, 22.06.2019 05:00
According to this food web which of the following would be considered primary consumers
Answers: 1
question
Biology, 22.06.2019 08:00
Which nucleotide component contains nitrogen
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Help me fast asap thx​
...
Questions
question
Mathematics, 29.09.2020 21:01
question
Physics, 29.09.2020 21:01
question
Mathematics, 29.09.2020 21:01
question
Mathematics, 29.09.2020 21:01
question
Mathematics, 29.09.2020 21:01