Rattlesnake Species
100
Average Length (cm)
8 8 8 8 8 8 8 %
60
Mojave
...
![subject](/tpl/images/cats/biologiya.png)
Biology, 16.02.2021 22:00 parminder44
Rattlesnake Species
100
Average Length (cm)
8 8 8 8 8 8 8 %
60
Mojave
Massasauga
Western
Diamondback
O
Black-tailed
1. Which type of information about rattlesnakes
does the bar graph above show? SCIL15.2
adaptation
evolution
mimicry
variation
I needdd help pls
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:30
Match the descriptions / definitions with the term they best describe 1. three dimensional relationship of the different polypeptide chains in a multisubunit protein or protein complex 2. common folding pattern in proteins in which a linear sequence of amino acids folds into a right-handed coil stabilized by internal hydrogen-bonding between polypeptide backbone atoms. 3. the amino acid sequence of a protein 4. a region on the surface of a protein that can interact with another molecule through noncovalent bonding. 5. three-dimensional arrangement of alpha-helices and beta-sheets within a single polypeptide, typically stabilized by a variety of noncovalent bonds, including ionic and hydrogen bonds, and nonpolar interactions / hydrophobic force. 6. the chain of repeating carbon and nitrogen atoms, linked by peptide bonds, in a protein. 7. common structural motif in proteins in which different sections of the polypeptide chain run alongside each other and are joined together by hydrogen bonding between atoms of the polypeptide backbone. 8. portion of a polypeptide chain that has a discrete tertiary structure of its own and can often fold independently of the rest of the chain 9. regular local folding patterns in a protein, including alpha-helix and beta-sheet a. primary structure b. beta-sheet c. protein d. coiled-coil e. polypeptide backbone f. secondary structure g. side chain h. tertiary structure i. binding site j. alpha-helix k. quaternary structure l. protein domain
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:20
In what part of a chloroplast does glucose production occur? a. atp synthase b. photosystem ii c. photosystem d. stroma
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:30
The carbon cycle is best defined as a process in which a. carbon changes from inorganic forms to organic forms and back b. carbon is changed into other elements such as oxygen or nitrogen c. carbon is continually created from the sun’s energy by plants d. carbon is consumed and regenerated from other elements such as oxygen and nitrogen
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 11.05.2021 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/User.png)
Engineering, 11.05.2021 23:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 11.05.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 11.05.2021 23:50
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.05.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 11.05.2021 23:50
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 11.05.2021 23:50
![question](/tpl/images/cats/istoriya.png)
History, 11.05.2021 23:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 11.05.2021 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.05.2021 23:50