Which statement describes an advantage of asexual reproduction?
A. Asexual reproduction results in variations in DNA.
B. Asexual reproduction causes less competition for resources.
*C. Asexual reproduction is faster than sexual reproduction.
D. Asexual reproduction requires more energy than sexual reproduction.
Answers: 1
Biology, 22.06.2019 01:30
What type of competition exsist between two species. turtles and fish
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:40
Which statement describes how favorable traits in a population relate to natural selection? they are the only traits that ever exist in the population. they build in the population over time. they are rarely passed on to offspring. they are found only in a few individuals within the population.
Answers: 1
Which statement describes an advantage of asexual reproduction?
A. Asexual reproduction results in...
Biology, 20.10.2021 02:00
Arts, 20.10.2021 02:00
Mathematics, 20.10.2021 02:00
English, 20.10.2021 02:00
Mathematics, 20.10.2021 02:00
English, 20.10.2021 02:00
Mathematics, 20.10.2021 02:00
Mathematics, 20.10.2021 02:00
Chemistry, 20.10.2021 02:00
SAT, 20.10.2021 02:00