subject
Biology, 12.02.2021 23:00 lizzyhearts

Explain why nitrogen is important to organisms

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 14:50
What must happen before meiosis can begin? a. four gametes must be produced b. the four tetrads must be pulled apart c. dna doubles and produces sister chromatids d. the cell membrane pinches together
Answers: 1
question
Biology, 22.06.2019 04:00
The tubes transporting minerals and water upward are called ?
Answers: 1
question
Biology, 22.06.2019 11:00
You want to cultivate some exotic plants at your farm. however, the climate is chillier than the temperature range favorable to the crop. which is the best method to use for the cultivation of this exotic crop? a. use a crop rotation method b. use a lot of fertilizer c. prepare the seed bed properly d. use a greenhouse e. use irrigation
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Explain why nitrogen is important to organisms...
Questions
question
Mathematics, 14.04.2021 06:40
question
Mathematics, 14.04.2021 06:40
question
Chemistry, 14.04.2021 06:50