What cross will result in a ratio of 3 dominant phenotype offspring for every 1 recessive offspring?

If your client can successfully complete two or more repetitions above the desired repetition range in the last set in two consecutive workouts for any given exercise, the load should be depending on your client's current physical abilities. increased by 1-5% increased by 2-10% increased by 5-15% increased by 10-20% none of these

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Part a - which gene to compare? in this exercise, you will use the cytochrome c oxidase i (coi) gene to investigate relationships among salmon species. (this gene encodes a protein that functions in the mitochondrial electron transport chain.) you will compare the coi gene sequences from your salmon test samples to the standard sequences for each salmon species. in order for the coi gene to be useful for distinguishing among the different salmon species, which three statements must be true?