subject
Biology, 10.02.2021 18:40 jocelynn2379

HEL30 points DONT ANSWER IF YOU'RE NOT GOING TO HELP I WILL REPORT YOU The image shows a lake, a factory, a cloud in the sky, a cow, dead organisms, a tree, and the sun. An arrow from the sun to the tree is labeled A. An arrow from the sky to the tree is labeled B. The sky is labeled C above the cloud. The letter D is in the air and an arrow points from it down to dead organisms. An arrow points from dead organisms to the ground labeled E. An arrow points from the cow into to the sky labeled F. An arrow points from the factory to the sky labeled G. An arrow from the sky to the lake is labeled H above the lake.

Using the diagram above, match the description to the corresponding location in the carbon cycle model. Provide the letter only.

Carbon dioxide is converted to sugar used for food.
Carbon trapped in fossil fuels is converted to carbon dioxide.
Organic carbon is converted to fossil fuels.
Carbon dioxide is converted to carbonates.
Sugar is broken down and converted to carbon dioxide.
Location
Location
Location
Location
Location

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 20:30
How can scientists test their ideas about the origin of the universe if they can't physically interact with or study?
Answers: 2
question
Biology, 22.06.2019 03:30
If assuming tasting ptc as a simple gene trait,what other genotype would you select to put in this missing genotype box that could result in this phenotype
Answers: 3
question
Biology, 22.06.2019 03:50
Why was mendel's work not accepted at the time? o a. his results were false. o b. he did not repeat his experiments. o c. he did not have any data. o d. his results were surprising,
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
HEL30 points DONT ANSWER IF YOU'RE NOT GOING TO HELP I WILL REPORT YOU The image shows a lake, a fa...
Questions
question
Social Studies, 19.03.2020 07:22
question
Mathematics, 19.03.2020 07:23
question
Mathematics, 19.03.2020 07:23